Pipeline preprocess_quantseq_fed
Overview
This pipieline cuts adaptors from quantseq data according to the `Lexogen FAQ<https://faqs.lexogen.com/faq/what-is-the-adapter-sequence-i-need-to-use-for-t-1>`_:
“In general we can recommend using cutadapt (v.1.18) with the following parameters for read 1 trimming.”
cutadapt -m 20 -O 20 -a "polyA=A{20}" -a "QUALITY=G{20}" -n 2 ${R1_raw} | cutadapt -m 20 -O 3 --nextseq-trim=10 -a "r1adapter=A{18}AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC;min_overlap=3;max_error_rate=0.100000" – | cutadapt -m 20 -O 20 -g "r1adapter=AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC;min_overlap=20" --discard-trimmed -o ${R1_trimmed} –
Configuration
The pipeline requires a configured preprocess_quantseq_fwd.yml file.
Default configuration files can be generated by executing:
txseq preprocess_quantseq_fwd config
Inputs
The pipeline requires the following inputs
fastqs.tsv: A text file containing the paths of the FASTQ files to be processed, one per line.
Requirements
The following software is required:
Output files
The pipeline produces the following outputs:
cutadapt processed FASTQ files: in the “cutadapt.dir” sub-folder.
Code
- txseq.pipeline_preprocess_quantseq_fwd.cutadapt(infile, sentinel)
Run cutadapt on Lexogen quantseq FWD data